Profile avatar
iimabeans.bsky.social
i like sad music and cool looking rocks~ 😎 educator | cardgame enthusiast | tired 👉🏳️‍⚧️👈
21 posts 18 followers 15 following
Regular Contributor
Posts 17 Comments 7

I'M LIVE RIGHT NOW, DONATE FOR TRANS RIGHTS

submitted 26 days ago • 3 comments

either I got really lucky again or TSA agents are getting really good at sniffing out trans people I got to skip the penis-detection-machine TWO TIMES IN A ROW 🫡🥹🥳 patdownless vacation would you believe it

submitted 58 days ago • 0 comments

fish oil pill was extra sloppy this morning and I had to physically restrain myself from popping it like a gushers between my fingers

submitted 59 days ago • 0 comments

*two prokaryotes in 3,700,000,000 BC* what if we kissed in the primordial stew...

submitted 71 days ago • 0 comments

who's going to stop me from putting buzzcut season by Lorde on every playlist I own in the year 2024(5)???

submitted 71 days ago • 0 comments

my students won't stop asking where the fresh blood sample for our lab is coming from. I'm gonna keep not telling them and keep showing up to school with more bandaids on my fingers until they figure it out

submitted 73 days ago • 0 comments

took my estrogen and got a goodnight kiss. everything is okay now

submitted 76 days ago • 0 comments

my stupid dog won't stop reciting the Kybalion when I try to cut his hair,,, I know you're excited about planar vibration frequencies LET ME TRIM YOUR MUSTACHE PLEASE

submitted 78 days ago • 0 comments

incredible how putting on makeup turns a bad day into a bad day with makeup on

submitted 78 days ago • 0 comments

she sequence on my genome till I ATGGCGATCCTAGGTCATGC

submitted 83 days ago • 0 comments

I know two authors who told me to buy their book in any way OTHER than using Amazon because it earns them the least money. Shop local and support indie authors!

submitted 85 days ago • 0 comments

i wish there was a song for those of us who are not sick, yet arent entirely well either

submitted 85 days ago • 319 comments

engineers be like: *employed*

submitted 87 days ago • 0 comments

every time Drew Polovick writes a bass line a really cool bug gets its wings anyways I'm learning Spectator by FPC right now

submitted 88 days ago • 0 comments

sorry I couldn't help unload the groceries I was holding space for the lyrics of defy gravity

submitted 88 days ago • 0 comments

submitted 88 days ago • 414 comments

silly string is just regular string to me

submitted 88 days ago • 1 comment