josepmercader.bsky.social - Profile | ThreadSky | a Reddit-style client for Bluesky

@elaineywchen.bsky.social www.statnews.com/2025/03/17/t...

submitted 2 days ago • 0 comments

Very interesting paper showing that pooled GWAS analysis has better power than ancestry stratified meta-analysis for large multi-ancestry biobanks from Haoyu Zhang, Peter Kraft and Julie-Alexia Dias (could not find them in Bluesky) www.medrxiv.org/content/10.1...

submitted 6 days ago • 0 comments

Some thoughts on the new dynamic uncertain status and need for US-Canada Science diplomacy www.science.org/doi/10.1126/...

submitted 6 days ago • 1 comment

I stand with Jim. It makes me sad that I will miss my friends and family but I am staying away until their ship is righted, which could be a long time from now.

submitted 7 days ago • 1 comment

Congratulations to @prsdiversity.bsky.social researchers @eimearekenny.bsky.social and @genandgenes.bsky.social, featured in @geneticssociety.bsky.social #WomensHistoryMonth

submitted 7 days ago • 0 comments

Excited to share this position for a computational biologist to work on Translational Diabetes Genomics in Diverse populations. Great opportunities to learn and grow and expand your career ! Please share! broadinstitute.avature.net/en_US/career...

submitted 10 days ago • 0 comments

Presidents of #Harvard, #Yale, #Princeton, #Stanford, #MIT, #Penn, #NotreDame, #Columbia, #Northwestern, #JohnsHopkins should stop hiding under the bed & collectively stand up w/ other university leaders to fight back against #Trump, #Musk. You already have targets on your backs. Fight. Damn it.

submitted 10 days ago • 19 comments

STAND UP FOR SCIENCE SPEAKER ANNOUNCEMENT! ☀️ Dr. Francis Collins will be speaking at Stand Up for Science in D.C. on March 7th! More speaker announcements coming soon, stay tuned! 👀☀️

submitted 14 days ago • 13 comments

Yeah...to say I am fangirling over here is an understatement. 😂👀🫶🏼

submitted 14 days ago • 2 comments

Ouch

submitted 16 days ago • 0 comments

PUBMED is down. This is disaster !! We do not have the system and organization to replace it. (EuroPMC is great but not a replacement) It is crystal clear that we cannot depend on critical systems provided by a single provider. European reaction has to include science and science infrastructures.

submitted 18 days ago • 24 comments

Welcome to the Bluesky account for Stand Up for Science 2025! Keep an eye on this space for updates, event information, and ways to get involved. We can't wait to see everyone #standupforscience2025 on March 7th, both in DC and locations nationwide! #scienceforall #sciencenotsilence

submitted 35 days ago • 300 comments

This Texas scientist is going to be in Massachusetts and participating! Who will I get to see there?

submitted 22 days ago • 2 comments

In 2022, I participated in the important NHGRI Workshop "Future Directions in Genomics & Health Equity Research". The program & accompanying materials were available online. They are now gone. This makes me so sad, especially for our wonderful colleagues at NIH who care about this work deeply.

submitted 24 days ago • 4 comments

Scientists, we need your stories! Post a 2-minute video on whatever social media apps you use. Show us your empty labs, tell us about the grant you are waiting for, and talk about why you do what you do. Tag @c4lifesciences.bsky.social and #Cuts2Science Tag your Members of Congress!

submitted 27 days ago • 1 comment

Introducing the Adipose Tissue Knowledge Portal integrating clinical and experimental results with transcriptomic and proteomic data from >6,000 women and men @cp-cellmetabolism.bsky.social @ki.se www.cell.com/cell-metabol...

submitted 27 days ago • 0 comments

SCOOP: The National Academies of Science, Engineering, and Medicine, arguably the nation's most powerful scientific organization, is bending to political pressure and removing terms like "health equity" from pending reports. Members are not happy. Story by me: www.statnews.com/2025/02/20/n...

submitted 27 days ago • 35 comments

Almost all grant-review meetings under Trump 2.0 remain suspended at the US National Institutes of Health (NIH), preventing the world’s largest public funder of biomedical research from spending much of its US$47 billion annual budget. https://go.nature.com/4gM6oW4

submitted 27 days ago • 8 comments

Stand Up For Science 2025 Announces National Day of Action WHO: Everyone! If your life is better because of science, this rally is for you. WHERE: Washington, DC & state capitals nationwide WHEN: March 7, 2025 Forthcoming details about local rallies: www.standupforscience2025.org

submitted 33 days ago • 0 comments

This is very cool work (where I was fortunate to play a small part), providing creative and crucial solutions for secure and federated eQTL mapping. Bigger functional genetic studies with less administrative and legal hassle! 💪

submitted 35 days ago • 0 comments

So fantastic that NPR featured the unexplained troublingly high rates of heart disease among S Asian individuals, and our research efforts with the OurHealth Study to address these issues! www.npr.org/2025/02/11/n... @broadinstitute.org @prsdiversity.bsky.social

submitted 36 days ago • 1 comment

Federal judge expands block on NIH indirect cost rate cut to institutions nationwide after additional lawsuits www.cnn.com/2025/02/11/p...

submitted 36 days ago • 3 comments

Breaking news: 22 states are suing to block NIH’s cutting of indirect costs. See our updated story on the Friday night news and its aftermath. scim.ag/4hTJQ6v

submitted 37 days ago • 6 comments

JUST IN: A federal judge in Massachusetts has blocked the Trump administration's rate change to NIH grants. storage.courtlistener.com/recap/gov.us...

submitted 37 days ago • 74 comments

BREAKING: 22 states sue NIH over Trump administration's new 15% cap on overhead for federal research grants. Suit filed federal court in Boston contends lifesaving research 'will grind to a halt' under the policy. Doc: storage.courtlistener.com/recap/gov.us...

submitted 37 days ago • 65 comments

It’s been a tough few weeks. My 10yo daughter was diagnosed with a very rare, aggressive cancer called interdigitating dendritic cell sarcoma (IDCS). I’m reaching out to identify clinicians/patients who have encountered pediatric IDCS or other (non-LCH) dendritic or histiocytic sarcomas cases.

submitted 39 days ago • 86 comments

The long awaited European guidelines for the use of Polygenic score for primary prevention of cardiovascular diseases are out! It took > 10 years from the first results proposing its use as additional screening factor among patients with intermediate CVD risk academic.oup.com/eurheartj/ad...

submitted 41 days ago • 0 comments

🧵 When Medicine and Science Ignores Diversity, People Die. 1/ Ignoring diversity in medicine and science is deadly. From unethical experiments to life-threatening misdiagnoses, history is replete with examples of how neglecting race, gender, and identity costs lives. A thread of concrete examples.

submitted 42 days ago • 24 comments

I have to say I am DYING at the fact that "female" and "women" are on these NSF/NIH flag lists and "men" isn't!!!!!! Fragile masculinity scientists rise up!!!!! It's your time

submitted 43 days ago • 3 comments

Thank you @bmj.com for modeling how to point out and push back on unscientific, unfounded, immoral and probably illegal directives from the Trump administration

submitted 43 days ago • 0 comments

The website for the NIH Office of Research on Women's Health has nearly been dismantled between yesterday morning and today. Piece by piece throughout the day. What, the new administration will no longer support or tolerate discussion of research affecting the health of >50% of humans? Seriously?!?

submitted 47 days ago • 1 comment

This is what the government did with 120K+ Japanese Americans in 1942. I know. I was there in those camps.

submitted 47 days ago • 3608 comments

A new gene-editing treatment extends lifespan by about 50 percent in a mouse model of prion disease and could lead to a preventative, one-time treatment for the deadly neurodegenerative disorder. #Science

submitted 64 days ago • 0 comments

Despite similar performance at the population level, different coronary heart disease polygenic risk scores produced highly variable individual-level risk estimates. https://ja.ma/3W8RykL

submitted 67 days ago • 0 comments

Humans tend to inherently believe that context matters. But context doesn’t seem to matter all that much in genetics. Epistasis between mutations doesn’t seem to influence their stability in this amazing saturation mutagenesis paper. www.nature.com/articles/s41...

submitted 65 days ago • 1 comment

New GWAS association method, more powerful, but not more expensive than existing methods www.nature.com/articles/s41...

submitted 69 days ago • 0 comments

With great sadness, we announce the passing of Dr. Joan Guinovart, founder, former scientist, director, and Emeritus Professor of IRB Barcelona. Our deepest condolences to his loved ones and the IRB Barcelona community. You will always be remembered, Captain.

submitted 77 days ago • 6 comments

200% agree with this entire thread.

submitted 90 days ago • 3 comments

👀 📆 Mark your new 2025 calendars for the Jan 15 @geneticssociety.bsky.social journal club, where Iftikhar Kullo @mconomos.bsky.social and @blueyedgenes.bsky.social will present the PRIMED Perspective paper www.cell.com/ajhg/fulltex.... Register for free at learning.ashg.org/products/ove...

submitted 89 days ago • 0 comments

My top highlight for 2025 - EMBO workshop in Saint Feliu - three exciting days of science crossing boundaries of liver & pancreas research! Co-organised by @CebolaLab @1jorgeferrer @VallierLab @LickertHeiko & Emma Anderson #livertwitter #islets #masld #diabetes meetings.embo.org/event/25-liv...

submitted 90 days ago • 0 comments

🎆 Ring in the new year by reviewing the PRIMED Consortium's progress on improving genetic risk prediction in diverse genetic ancestry populations. See our Research Highlights https://buff.ly/4iUpmfw and video collection https://buff.ly/4iKIbli

submitted 90 days ago • 0 comments

Who would have thought that an actual sequence of a #microexon (GCAAGGACATATGGGCGAAGGAGA from CPEB4) would be in the headline of an article in @elpais.com! Congrats to the Mendez, @xsalvatella1.bsky.social and @jjlucaslab.bsky.social labs for this amazing work! english.elpais.com/science-tech...

submitted 104 days ago • 1 comment

There are now 24 step-by-step guides, explaining how to create these ⬇️ data visualizations with R/ggplot2 - I hope this is a useful resource. Find them all here: joachimgoedhart.github.io/DataViz-prot...

submitted 94 days ago • 18 comments

The genetic architecture of gene expression in individuals of African and European ancestry https://www.medrxiv.org/content/10.1101/2024.12.13.24318019v1

submitted 93 days ago • 0 comments

New work! Wherein we (as in, the AVE ODIC working group) looked at clinical variant classification across genetic ancestry groups in gnomAD and AoU and what we found... is exactly what you might expect, after decades of Eurocentric research. But we also show there's a better way forward! 🧬🖥️

submitted 335 days ago • 2 comments

Million Veteran Program & FinnGen teams are pleased to release v1 meta-analysis of MVP, FinnGen and UKBB GWAS data. This first version includes ~300 binary disease definitions across >1.5 M individuals. Browse scans at: mvp-ukbb.finngen.fi

submitted 104 days ago • 1 comment

🫧🔍Key breakthrough in #autism: pivotal role of #CPEB4 condensates revealed. 💊The study opens new avenues for the development of targeted treatments for autism. 📰 Nature @natureportfolio.bsky.social ✍️ Carla Garcia-Cabau, Anna Bartomeu et al. ➡️ bit.ly/3BfEGlR 📌 DOI: 10.1038/s41586-024-08289-w

submitted 105 days ago • 2 comments